View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_72 (Length: 244)
Name: NF9751_low_72
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 32830786 - 32830567
Alignment:
| Q |
17 |
actttttggtgtcacaatcattatgggaatagcaaagacatgttttgttctattttcagcattggtattagacaaatttggaagaaggcccatgctgttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
32830786 |
actttttggtgtcacaatcattatgggaatagcaaagacatgttttgttctattttcagcattggtattagacagatttggaagaaggcccatgttgttg |
32830687 |
T |
 |
| Q |
117 |
ttgggctcatcaggtatggcagtgtccttatttgggcttggaatgggatgtactttacttcacaattcagatgaaaagcccatgtgggctattgctttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32830686 |
ttgggctcatcaggtatggcagtgtccttatttgggcttggaatgggatgtactttacttcacaattcagatgaaaagcccatgtgggctattgctttgt |
32830587 |
T |
 |
| Q |
217 |
gtgtggttgctgtctgtgct |
236 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
32830586 |
gtgtggttgctgtttgtgct |
32830567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University