View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_75 (Length: 242)
Name: NF9751_low_75
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_75 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 140 - 242
Target Start/End: Complemental strand, 2516802 - 2516700
Alignment:
| Q |
140 |
atttggtttagtaattggaatttgtgttattctctttaaatttgctactgtctgcaactaatttagtggcactgttatttcaacaaaatccattaccatt |
239 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2516802 |
atttgctttagtaattggaatttgtgttattctttttaaatttgctactgtctgcaactaatttagtggcactgttatttcaacaaaatccattaccatt |
2516703 |
T |
|
| Q |
240 |
acc |
242 |
Q |
| |
|
||| |
|
|
| T |
2516702 |
acc |
2516700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 2524460 - 2524410
Alignment:
| Q |
22 |
tgactcaacggttcatttctttgcactcgtcttcttttaccttctaatgct |
72 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
2524460 |
tgactcaacacttcatttctttgcactcatcttcttttgccttctaatgct |
2524410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University