View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_82 (Length: 232)
Name: NF9751_low_82
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_82 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 215
Target Start/End: Complemental strand, 6650225 - 6650041
Alignment:
| Q |
19 |
tgttgtagatttattcatcaattcatgttgattatgtaaaattctcctgaattgtagccaccctgcaatttgttatactttcgctaaccctttagattta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6650225 |
tgttgtagatttattcatcaattcatgttgattatgtaaaattctcctgaattgtagccaccctgcaatttgttatacttt------------agattta |
6650138 |
T |
 |
| Q |
119 |
tgcatgtccggtgtctgacatgcgttagtgttgaaaaccgacacatgcgattacattctattgcttctatttttaaaattattaccggtgttgatgt |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650137 |
tgcatgtccggtgtctgacatgtgttagtgttgaacacctacacatgtgattacattctattgcttctatttttaaaattattaccggtgttgatgt |
6650041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University