View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_86 (Length: 219)
Name: NF9751_low_86
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_86 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 2194683 - 2194598
Alignment:
| Q |
9 |
tatatttatgtgttttattatgcactgagtctaattattgtgtaatattgttgatataattaagcacaataaccgagaaaatatat |
94 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2194683 |
tatatttatgtgttttattatgcattgagtctaattattttgtaatattaatgatataattaagcacaataaccgagaaaatatat |
2194598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 136 - 202
Target Start/End: Complemental strand, 2194592 - 2194526
Alignment:
| Q |
136 |
aaaatcaaaacgttccaaatatgtgaaataaaaatttaagtgtcttaggactttttgttattcttgc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2194592 |
aaaatcaaaacgttccaaatatgtgaaataaaaatttaagtgttttagcactttttgttattcttgc |
2194526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University