View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_87 (Length: 207)
Name: NF9751_low_87
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 53558209 - 53558385
Alignment:
| Q |
15 |
gagaagagtactaacaatgaaggaattcaggaactggaaagtgaactagatgaaattctcaacaacagaaatataattactatggaagatgaatatcgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53558209 |
gagaagagtactaacaatgaaggaattcaggaactggaaagtgaactagatgaaattctcaacaacagaaatataattactatggaagatgaatatcgtg |
53558308 |
T |
 |
| Q |
115 |
tggctgaatttgattgtttcagagatatgaataataatggttcaaaggatcaaaacttgatatggtggtcaaatgat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53558309 |
tggctgaatttgattgtttcagagatatgaataataatggttcaaaggatcaaaacttgatatggtggtcaaatgat |
53558385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University