View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9751_low_87 (Length: 207)

Name: NF9751_low_87
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9751_low_87
NF9751_low_87
[»] chr4 (1 HSPs)
chr4 (15-191)||(53558209-53558385)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 53558209 - 53558385
Alignment:
15 gagaagagtactaacaatgaaggaattcaggaactggaaagtgaactagatgaaattctcaacaacagaaatataattactatggaagatgaatatcgtg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53558209 gagaagagtactaacaatgaaggaattcaggaactggaaagtgaactagatgaaattctcaacaacagaaatataattactatggaagatgaatatcgtg 53558308  T
115 tggctgaatttgattgtttcagagatatgaataataatggttcaaaggatcaaaacttgatatggtggtcaaatgat 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53558309 tggctgaatttgattgtttcagagatatgaataataatggttcaaaggatcaaaacttgatatggtggtcaaatgat 53558385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University