View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9752_low_9 (Length: 291)
Name: NF9752_low_9
Description: NF9752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9752_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 7026225 - 7026391
Alignment:
| Q |
1 |
attgtccacactatcttgttttataattttgaaaagcattttcaattagactttgctttcattatttattaaaatgaattcttcctaatttgttttcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7026225 |
attgtccacactatcttgttttataattttgaaaagcattttcaattagactttgctttcattatttattaaaatgaattcttcctaatttgttttcaat |
7026324 |
T |
|
| Q |
101 |
aactctaccttctctctatcgcaaatattcatttccttgttagcagaatttaaaatcaacataaatt |
167 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7026325 |
aactctaccttctctcgatggcaaatattcatttcctcgttagcagaatttaaaatcaacataaatt |
7026391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 193 - 291
Target Start/End: Original strand, 7026415 - 7026518
Alignment:
| Q |
193 |
gtttttagaaagtaaacaaggtgacttataatctaggaatcactaacgcagtcaaggataccg-------ataggtcggactcgccttcaatcagtagtg |
285 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| ||||||| ||| || |||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
7026415 |
gtttttagaaagtaatcaaggt--cttataatctaggaagcactaacacagacagggataccggacataaatatgtcggacacgccttcaatcagtagtg |
7026512 |
T |
|
| Q |
286 |
tcggct |
291 |
Q |
| |
|
|||||| |
|
|
| T |
7026513 |
tcggct |
7026518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University