View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_high_14 (Length: 357)
Name: NF9753_1D_high_14
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 96 - 312
Target Start/End: Complemental strand, 40514365 - 40514149
Alignment:
| Q |
96 |
aaggacaaatggtgaaagctagtatttgaaccaagcaattaaattcctacttttataccctacaagtttgatgatcatattcctaaaccttggatacaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514365 |
aaggacaaatggtgaaagctagtatttgaaccaagcaattaaattcctacttttataccctacaagtttgatgatcatattcctaaaccttggatacaaa |
40514266 |
T |
|
| Q |
196 |
gactagacgtctttaaagatttataattgtagctttataccctaggagccatgcttcattagctcctgcagtagaaagagggtatggggctggagttagt |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514265 |
gactagacgtctttcaagatttataattgtagctttataccctaggagccatgcttcatcagctcctgcagtagaaagagggtatggggctggagttagt |
40514166 |
T |
|
| Q |
296 |
cactggtgtaggaaaat |
312 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40514165 |
cactggtgtaggaaaat |
40514149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 42667705 - 42667642
Alignment:
| Q |
1 |
atgaacagtggcgatttagcgatgatactcatgttaaccgttatcgtggattggacttaaactt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667705 |
atgaacagtggcgatttagcgatgatactcatgttaaccgttatcgtggattggacttaaactt |
42667642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University