View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_high_17 (Length: 330)
Name: NF9753_1D_high_17
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 10660924 - 10661235
Alignment:
| Q |
1 |
aagaatgtacttaattggcattgaagctgtacattgaactggttagcaacaatatctacaaatttaattgctaccgatgtgccgcttctcgaaagaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10660924 |
aagaatgtacttaattggcattgaagctgtacattgaactggttagcaacaatatctacaaatttaattgctaccgatgtgtcgcttctcgaaagaaaaa |
10661023 |
T |
 |
| Q |
101 |
tcttttgaacttgaagttgtgccgatttcatgtctaacgctaaccggcaattcagttgtcgaaaatgactcgacaattggtatctcaatctcagatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661024 |
tcttttgaacttgaagttgtgccgatttcatgtctaacgctaaccggcaattcagttgtcgaaaatgactcgacaattggtatctcaatctcagatgcta |
10661123 |
T |
 |
| Q |
201 |
ctgtttggttgtttcttggtgaagttgatcctcctccttcaacatcccattgctcattttcatagttagaagtccttggagaagtttgtaaactgtcact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661124 |
ctgtttggttgtttcttggtgaagttgatcctcctccttcaacatcccattgctcattttcatagttagaagtccttggagaagtttgtaaactgtcact |
10661223 |
T |
 |
| Q |
301 |
gttgccaaaagt |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10661224 |
gttgccaaaagt |
10661235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University