View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_high_18 (Length: 304)
Name: NF9753_1D_high_18
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_high_18 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 10 - 304
Target Start/End: Complemental strand, 34872578 - 34872284
Alignment:
| Q |
10 |
gatagacatccacaacgtcaacaccatgattgctggggcaggactggactcttcttctcagcaggtagtggaggtggccgatgacgacaatatggaggta |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872578 |
gatagacatccaccacgtcaacaccatgattgctggggcaggactggactcttcttctcagcaggtagtggaggtggccgatgacgacaatatggaggta |
34872479 |
T |
 |
| Q |
110 |
gaggcgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcggtctgagggagaggatc |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
34872478 |
gaggtgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcagtctcagggagaggatt |
34872379 |
T |
 |
| Q |
210 |
tgctccagctgttgaacgtgcggtccgatcctgatcgatatggcccccactcgaccatttgccgcagtgatctaaagctgaaggttattcaagac |
304 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872378 |
tgctccaactgttgaacgtgtggtccgatcctgatcgatatggcccccactcgaccatttgccgcagtgatctaaagctgaaggttattcaagac |
34872284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University