View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_high_20 (Length: 258)
Name: NF9753_1D_high_20
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 86 - 235
Target Start/End: Original strand, 37160197 - 37160346
Alignment:
| Q |
86 |
tttggcttgtaatagagaattgaaattttgtttgtatgtttgacaaaataatgttttaaaataaactaaacttatattcttatgttaatgttgcaaaaca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160197 |
tttggcttgtaatagagaattgaaattttgtttgtatgtttgacaaaataatgttttaaaataaactaaacttatattcttatgttaatgttgcaaaaca |
37160296 |
T |
|
| Q |
186 |
atggtgtttaatgtttattctctttgtaaacgtacaatggatactataca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160297 |
atggtgtttaatgtttattctctttgtaaacgtacaatggatactataca |
37160346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 37151436 - 37151483
Alignment:
| Q |
10 |
taaattccattttgcattggaatcagaattgtgtgttagaatcatcat |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37151436 |
taaattccattttgcattggaatcagaattgtgtgttagaatcatcat |
37151483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University