View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_high_25 (Length: 219)
Name: NF9753_1D_high_25
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 195
Target Start/End: Original strand, 10761435 - 10761612
Alignment:
| Q |
18 |
gacatcagagtattgtgagacctgatgcacttaatcaaacactcattaatgtggtacaccactttcatttaagaagaccgtttatgttcactgatgtaga |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10761435 |
gacataagagtattgtgagacctgatgcacttaatcaaacactcattaatgtggtacaccactttcatttaagaagaccttttatgttcactgatgtaga |
10761534 |
T |
|
| Q |
118 |
aaaagatgtaatggtcattaaccattataaatatcaagtatggaaagtattcaaacaaaagttttataggagggttgc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10761535 |
aaaagatgtaatggtcattaaccattataaatatcaagtatggaaagtattcaaacaaaagttttataggagggttgc |
10761612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University