View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9753_1D_high_26 (Length: 218)

Name: NF9753_1D_high_26
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9753_1D_high_26
NF9753_1D_high_26
[»] chr2 (1 HSPs)
chr2 (34-196)||(39406454-39406618)
[»] chr4 (1 HSPs)
chr4 (33-196)||(50430696-50430859)
[»] chr7 (1 HSPs)
chr7 (30-136)||(21672478-21672584)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 34 - 196
Target Start/End: Complemental strand, 39406618 - 39406454
Alignment:
34 tttgctcattcgaaattacgacatcttcatagttgttgttgttttgggatcttcatcctcaaggaagctagatcttaatcattgttgt---tgttttgga 130  Q
    ||||||| |||||||||  ||||||||||||||  |||||||||||||| ||||||||||||||||||||||| ||||||||||||||   |||||||||    
39406618 tttgctcgttcgaaattgtgacatcttcatagtcattgttgttttgggaccttcatcctcaaggaagctagattttaatcattgttgttgttgttttgga 39406519  T
131 gcttttattgcagaaggtgggagagaatgaggagatgaagataaaacttataagtggtgagagaga 196  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||    
39406518 ggttttattgcagaaggtgggagagaatgaggagatgaagataaaactta-aaatggtgagagaga 39406454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 33 - 196
Target Start/End: Complemental strand, 50430859 - 50430696
Alignment:
33 ttttgctcattcgaaattacgacatcttcatagttgttgttgttttgggatcttcatcctcaaggaagctagatcttaatcattgttgttgttttggagc 132  Q
    |||||||| ||| ||||||||||||||||||||| ||||||||||||||| ||| |||||||| ||||||| ||||||||| ||||||||||||||||      
50430859 ttttgctccttcaaaattacgacatcttcatagtcgttgttgttttgggaacttgatcctcaaagaagctaaatcttaatcgttgttgttgttttggatg 50430760  T
133 ttttattgcagaaggtgggagagaatgaggagatgaagataaaacttataagtggtgagagaga 196  Q
    |||||||||| || || ||||||||||||||  ||||||||||||||| |||||||||||||||    
50430759 ttttattgcataaagtaggagagaatgaggaagtgaagataaaacttaaaagtggtgagagaga 50430696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 30 - 136
Target Start/End: Original strand, 21672478 - 21672584
Alignment:
30 aagttttgctcattcgaaattacgacatcttcatagttgttgttgttttgggatcttcatcctcaaggaagctagatcttaatcattgttgttgttttgg 129  Q
    ||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||    
21672478 aagttttgctcattcgaaattacgatatcttcatagtcgctgttgttttgggatcttcaacctcaaagaagctagatcttaatcattgttcttgttttgg 21672577  T
130 agctttt 136  Q
    || ||||    
21672578 aggtttt 21672584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University