View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_13 (Length: 362)
Name: NF9753_1D_low_13
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 13 - 362
Target Start/End: Complemental strand, 46839342 - 46838993
Alignment:
| Q |
13 |
atggacatcagacataaagcannnnnnnctgcaattagtttcttgtcttgaacatagtaaggtcgatttacagtttctgcatcacttgggtgggtttttt |
112 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46839342 |
atggacataagacataaagcatttttttctgcaattagtttcttgtcttgaacatagtaaggtcgatttacagtttctgcatcacttgggtgggtttttt |
46839243 |
T |
 |
| Q |
113 |
atggtttgcctgctcaatactgaatgattaaccagtcatcgttctattcatcagtgatctttgtaatttatttagacagattctccaatatgctgtgtat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46839242 |
atggtttgcctgctcaatactgaatgattaaccagtcatcgttctattcttcagtgatctttgtaatttatttagacagattctacaatatgctgtgtat |
46839143 |
T |
 |
| Q |
213 |
aatcttgaaagacatcaaattaacactannnnnnnnnacagttttgttgatattattaggtcaagggtataaaagtggagttgttattgcgggggaataa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
46839142 |
aatcttgaaagacatcaaattaacactatttttttttacagttttgttgatattattaggtcaagggtataaaattggagttgttattgcgtgggaataa |
46839043 |
T |
 |
| Q |
313 |
aatgtcacgtaaatgtgcaaaatagttgggtgggttttgcaattgacaca |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46839042 |
aatgtcacgtaaatgtgcaaaatagttgggtgggttttgcaattgccaca |
46838993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University