View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_22 (Length: 317)
Name: NF9753_1D_low_22
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 34429576 - 34429888
Alignment:
| Q |
1 |
gtagaagtagtagaagtaaacgtataaaatcggaatacaaagaaggcgacgatgatgatgatgaggaggatggtatgggtgttgagaatgcaaagcaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34429576 |
gtagaagtagtagaagtaaacgtataaaatcggaatacaaagaag---acgatgatgatgatgagggggatggtatgggtgttgagaatgcaaagcaaca |
34429672 |
T |
|
| Q |
101 |
ggaaaagaagaatggttgggaaaatgaatgcaaagtgttggaggaggctgtgttagcagcaagagatgatgcttctgatgagaatttggtgaagttgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429673 |
ggaaaagaagaatggttgggaaaatgaatgcgaagtgttggaggaggctgtgttagcagcaagagatgatgcttctgatgagaatttggtgaagttgttg |
34429772 |
T |
|
| Q |
201 |
aaattgattcatggttttgattcttttcgagaggggcagcttgaggcgattaagaatgtgcttgctgggaaatcgacgatgcttattttgccgactggtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429773 |
aaattgattcatggttttgattcttttcgagaggggcagcttgaggcgattaagaatgtgcttgctgggaaatcgacgatgcttattttgccgactggtg |
34429872 |
T |
|
| Q |
301 |
ctgggaaatcgttgtg |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34429873 |
ctgggaaatcgttgtg |
34429888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 266
Target Start/End: Original strand, 45160478 - 45160527
Alignment:
| Q |
217 |
ttgattcttttcgagaggggcagcttgaggcgattaagaatgtgcttgct |
266 |
Q |
| |
|
||||||| ||||| ||| || ||||||||||||||||||||||||||||| |
|
|
| T |
45160478 |
ttgattcatttcgggagaggtagcttgaggcgattaagaatgtgcttgct |
45160527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University