View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_34 (Length: 255)
Name: NF9753_1D_low_34
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 9799180 - 9799342
Alignment:
| Q |
1 |
atatgtttatataggggctatctaactgtataacatctgtaactaacaaactctataagctgtgctattctatgtaaggtacttggtaaaggaaacttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9799180 |
atatgtttatataggggctatctaactgtataacatctgtaactaacaaactctataagctgtgctattctatgtaaggtacttggtaaaggaaacttag |
9799279 |
T |
|
| Q |
101 |
agcacaagttaatttgcacaactagttaactatggtgtaaccagaagtttaacagatagtata |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9799280 |
agcacaagttaatttgcacaactagttaactatggtgtaaccagaagtttaacagatagtata |
9799342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 9790184 - 9790287
Alignment:
| Q |
20 |
atctaactgtataacatctgtaactaacaaactctataagctgtgctattctatgtaaggtacttggtaaaggaaacttagagcacaagttaatttgcac |
119 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| ||||| |||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
9790184 |
atctaactgtataacagctgtaactgacaaactctataagttgtgctattctatgtagggtacatggtaagggaaacttaaagcacaagttaacttgcac |
9790283 |
T |
|
| Q |
120 |
aact |
123 |
Q |
| |
|
|||| |
|
|
| T |
9790284 |
aact |
9790287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University