View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_39 (Length: 242)
Name: NF9753_1D_low_39
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 14 - 191
Target Start/End: Original strand, 30366016 - 30366197
Alignment:
| Q |
14 |
attttaggcccccttgacattggagtt-ggggctaaattgctaaggtcctataaattgacagctctaattatgcccaatgttgtttgatttctgtttggg |
112 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||| |||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30366016 |
attttaggcccccttgacattggagttaggggccaaattgttaaggtcccataaattgagtgctctaagtatgcccaatgttgtttgatttctgtttggg |
30366115 |
T |
|
| Q |
113 |
acaggtttcacatgct---gtatgtatgtgtatagtttttaagtaactgcaacattggtctaatttacgaatacacatgata |
191 |
Q |
| |
|
|||||||||||||| | || ||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30366116 |
acaggtttcacatgttgtcgtgtgtatgtttatagtttttatgtagctgcaacattggtctaatttacgaatacacatgata |
30366197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 194 - 236
Target Start/End: Original strand, 30366218 - 30366260
Alignment:
| Q |
194 |
tgtgtgcatatctttactagtatggtctgttatagtcttttgt |
236 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
30366218 |
tgtgtgcatatctttactagtatgggctgttatagttttttgt |
30366260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University