View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_44 (Length: 236)
Name: NF9753_1D_low_44
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 38126230 - 38126448
Alignment:
| Q |
12 |
atgaaatgccaaagatgaatcatgattttggatggttaacaaatgaatggttaaaatgtacaatttcttggcaactatgttgacttgatcaaccattctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38126230 |
atgaaatgccaaagatgaatcatgattttggatggttaacaaatgaatagttaaaatgtacaatttcttggcagctatgttgacttgatcaaccattctt |
38126329 |
T |
 |
| Q |
112 |
tgggtttatcattagaaatatgttcctaatgatatgctaaattgtatgcaaaatttctttagagtattgttcaacttggtaggcaaaattctggtgaatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38126330 |
tgggtttatcattagaaatatgttcctaatgatatcctaaattgtatgcaaaatttctttagagtattgttcaacttggtaggcaaaattctggtgaatc |
38126429 |
T |
 |
| Q |
212 |
ctctaaactataccgctca |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38126430 |
ctctaaactataccgctca |
38126448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University