View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_47 (Length: 226)
Name: NF9753_1D_low_47
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 38080529 - 38080707
Alignment:
| Q |
12 |
gatggacatcacatgtgaagattcacttttggcagctccaattatcttggatttggtccttcttgctgaacttagcactagaatccagttcaaatctgaa |
111 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38080529 |
gatgcacaacacatgtgaagattcacttttggcagctccaattatcttggatttggtccttcttgctgaacttagcactagaatccagttcaaatctgaa |
38080628 |
T |
|
| Q |
112 |
caagaggtcattatctattgttgcttaaactgttatgtttattcaattattaaaaaactgtgagctaaatctattgctg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38080629 |
caagaggtcattatctattgttgcttaaactgttatgtttattcaattattaaaaaactgtgagctaaatctgttgctg |
38080707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 39700080 - 39700170
Alignment:
| Q |
21 |
cacatgtgaagattcacttttggcagctccaattatcttggatttggtccttcttgctgaacttagcactagaatccagttcaaatctgaa |
111 |
Q |
| |
|
||||||||| || || |||||||| ||||| ||||||||||| ||||| ||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
39700080 |
cacatgtgaggactcccttttggctgctcctattatcttggacttggttcttcttgctgagcttagcactagaattcagtttaaatctgaa |
39700170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University