View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_48 (Length: 223)
Name: NF9753_1D_low_48
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_48 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 223
Target Start/End: Complemental strand, 32030248 - 32030048
Alignment:
| Q |
20 |
tcaatttgtaggagaaaatattgtttaaaaaacttataactacaagattctaagtattttcttcataagtactactagttaagaaaattaactgatctgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32030248 |
tcaatttgtaggagaaaatattgtttaaaaaacttataactacaagattctaagtattttcttcataagtacta---gttaagaaaattaactgatctgg |
32030152 |
T |
 |
| Q |
120 |
ctctaaaattatgtccactctaagaatatcatagacagttttataggcttgtttatctctttcctctatttgttctaaagggggttacagctgcatgata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32030151 |
ctctaaaattatgtccactctaagaatatcatagacagttttataggcttgtgtatctctttcctctatttgttctaaagggggttacagctgcatgata |
32030052 |
T |
 |
| Q |
220 |
caga |
223 |
Q |
| |
|
|||| |
|
|
| T |
32030051 |
caga |
32030048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University