View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_53 (Length: 218)
Name: NF9753_1D_low_53
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 5 - 212
Target Start/End: Complemental strand, 1322176 - 1321979
Alignment:
| Q |
5 |
ggagttctggttcgacttgtggggagtgggatcatagtatctggatcaagtattatgatgtgggagactatgagtctatgacccatataccaaatttctt |
104 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1322176 |
ggagttctggttcaacttgtggggagtgggatcatagtatctggatcaagtattacgatgtgggagactatga--------cccatataccaaatttctt |
1322085 |
T |
|
| Q |
105 |
atcgttttgggtgaagatgtatgtcttatcattttgaatgaagatgtgacatctttctcttttgtggtcttggagcattgcctcattgttgctcatgacg |
204 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1322084 |
atcgttttgggtgaaaatgtatgt--tatcattttaaatgaagatgtgacatctttctcttttgtggtcttggagcattgcctcattgttgctcatgacg |
1321987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 4787337 - 4787293
Alignment:
| Q |
81 |
tatgacccatataccaaatttcttatcgttttgggtgaagatgta |
125 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
4787337 |
tatgacccatatacctcatttcttaacgtttagggtgaagatgta |
4787293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University