View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_59 (Length: 211)
Name: NF9753_1D_low_59
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 46356729 - 46356542
Alignment:
| Q |
1 |
cacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattgttgtgttgtg-----aattgagttgggttgtgtc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46356729 |
cacgtgtatcggtgttcattgcttggaggagtttgaggattaggcctggtgttagtgaagccattgttgtgttgtgttgtgaattgagttgggttgtgtg |
46356630 |
T |
|
| Q |
96 |
tgtctgagagagatgttatacagagcagtttctgttctcttgtgttgtgttttttgaattcaaaatgttgatttgtccgttgtgcctatt |
185 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46356629 |
tgt--gagagagatgttatacagaggagtttctgttctcttgtgttgtgttttttgaattcaaaatgttgatttgtccgttatgcctatt |
46356542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University