View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_62 (Length: 210)
Name: NF9753_1D_low_62
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 21 - 199
Target Start/End: Original strand, 22858416 - 22858597
Alignment:
| Q |
21 |
aattggagtgtgctacaaatattcttggcttgaagagaagaaagagatgatggtaacgctgaagaaggaag---attccgagttcgggaacgaacctttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22858416 |
aattggagtgtgctacaaatattcttggcttgaagagaagaaagcgatgatggtgacgccgaagaaggaagaagattccgagttcgggaacgaacctttt |
22858515 |
T |
 |
| Q |
118 |
ttcgtttatgtttccgtcaaatttaacacgctacgttccagttactgttacgattcaaatggttgttgccggtttgtttcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22858516 |
ttcgtttatgtttccgtcaaatttaacacgctacgttccagttactgttacgattcaaatagttgttgccggtttgtttcat |
22858597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University