View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_1D_low_8 (Length: 382)
Name: NF9753_1D_low_8
Description: NF9753_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_1D_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 124 - 335
Target Start/End: Complemental strand, 23332806 - 23332595
Alignment:
| Q |
124 |
ttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagaga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332806 |
ttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagaga |
23332707 |
T |
|
| Q |
224 |
tcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332706 |
tcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcat |
23332607 |
T |
|
| Q |
324 |
tcgtccacatat |
335 |
Q |
| |
|
||||||| |||| |
|
|
| T |
23332606 |
tcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 23333661 - 23333784
Alignment:
| Q |
1 |
agctcatcagcaacacgaacaacggttcctgaggtaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattac |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23333661 |
agctcatcagcaacacgaacaacagttcctgaggcaacgacaatgtgtacatttttcctggtaaatcatgacacaatatatcaaaacagcaaaaaattac |
23333760 |
T |
|
| Q |
101 |
ataaaacaaacttatcaacctctt |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
23333761 |
ataaaacaaacttatcaacctctt |
23333784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
330 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
372 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 330 - 372
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
330 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
372 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University