View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_high_22 (Length: 244)
Name: NF9753_2D_high_22
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 22 - 228
Target Start/End: Complemental strand, 38223841 - 38223635
Alignment:
| Q |
22 |
acaactatggcaggaatgaaggtatacagatttggcattaacctcagttttctcttctcttaatttcttctgaaatactaattcaatataaatgatcagt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38223841 |
acaactatggcaggaatgaaggtatacagatttggcattaacctcagttttctcttctcttaatttcttctgaaatactaattcaatataaatgatcagt |
38223742 |
T |
 |
| Q |
122 |
gatataatttaatagtttttctaagttttagtcttaatttccgactatcaggcccttggctacgagtttgacaatgacgagtttcatgcttatgtgcatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
38223741 |
gatataatttaatagtttttctaagttttagtcttaatttcctactatcaggcccttggctacgagtttgacaatgatgattttcatgcttatgtgcatg |
38223642 |
T |
 |
| Q |
222 |
gaagatt |
228 |
Q |
| |
|
||||||| |
|
|
| T |
38223641 |
gaagatt |
38223635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University