View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_high_29 (Length: 208)
Name: NF9753_2D_high_29
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 33121226 - 33121040
Alignment:
| Q |
1 |
catatattcaaatgtttataagtttaaaaattgctattttcaatattaaatctctacttttaatagaatccgccaagcttgagacttgggagaccgtaaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
33121226 |
catatattcaaatgtttagaagtttaaaaattgctattttcaatattaaatctctacttttaatagaaaccgccaagcttgagatttgggagaccgtaaa |
33121127 |
T |
 |
| Q |
101 |
acctctttcatcgaagcaagagagaaatggggagtgacttggtgctggaagagaaggagaggaagaagatattgcttgcaccagctt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33121126 |
acctctttcatcgaagcaagagagaaatggggagtgacttggtgctggaagagaaggagaggaagaagatattgcttgcaccagctt |
33121040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University