View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_low_25 (Length: 401)
Name: NF9753_2D_low_25
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 17 - 390
Target Start/End: Complemental strand, 10078904 - 10078531
Alignment:
| Q |
17 |
tgttgttagatgaggacggtgttggtgaatgaaaaggggacgagtttggttgtgcctgtggcactgtactgcatgaacctggggatggaatatgagctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078904 |
tgttgttagatgaggacggtgttggtgaatgaaaaggggacgagtttggttgtgcctgtggcactgtactgcatgaacctggggatggaatatgagctga |
10078805 |
T |
|
| Q |
117 |
actacctccatatggactgcttgcattgttcattgaattttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078804 |
actacctccatatggactgcttgcattgttcattgaattttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtc |
10078705 |
T |
|
| Q |
217 |
gatgcagatgctgaattgacattgttatttacacttaccacaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078704 |
gatgcagatgctgaattgacattgttatttacacttaccacaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttg |
10078605 |
T |
|
| Q |
317 |
agttgggggccaccatatgctgctgttgctgctgtaattgttcttcagactgttgcgcctgattatgatgtcca |
390 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10078604 |
agttgggggccaccatatgctgttgttgctgctgtaattgatcttcagactgttgcgcctgattatgatgtcca |
10078531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 22 - 320
Target Start/End: Original strand, 40776020 - 40776318
Alignment:
| Q |
22 |
ttagatgaggacggtgt---tggtgaatgaaaaggggacgagtttggttgtgcctgtggcactgtactgcatgaacctggggatggaatatgagctgaac |
118 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||||| |||||||| || ||||||||||| |||||| | ||||| ||||||||||| ||| | ||| |
|
|
| T |
40776020 |
ttagatgaggatggtgtaggtggtgactgaaaaggggatgagtttggctgggcctgtggcacagtactggaggaaccaggggatggaatctgaacagaat |
40776119 |
T |
|
| Q |
119 |
tacctccatatggactgcttgcattgttcattgaattttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||| |||||||||||||||||||| ||||||||||| || || |
|
|
| T |
40776120 |
tacctccatatggactgcttgcattgttcattgaattt---tgtctagaattcacagagttttggtggagaagtccaacaatagtgcttgtggttgttga |
40776216 |
T |
|
| Q |
219 |
tgcagatgctgaattgacattgttatttacacttaccacaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgag |
318 |
Q |
| |
|
||| || || || |||||| |||||||||| |||| ||||||| | |||| | |||||| | |||||||||||| | ||||||||| ||||||||| |
|
|
| T |
40776217 |
tgcggacgccgagttgacagaactatttacactaaccataccattgctggaagcaatttgcatggaagcagcttgcactgggttttgatcgccatttgag |
40776316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University