View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_low_28 (Length: 355)
Name: NF9753_2D_low_28
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 14 - 336
Target Start/End: Original strand, 10844265 - 10844587
Alignment:
| Q |
14 |
ctttcaacttattatttgatgaaacatttttagtagattttgatgatattggccagtgtccactagtaacagccatatctttaaactgttctaggctttc |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10844265 |
ctttcaccttattatttgatgaaacatttttagtagattttgatgatattggccagtgtccactagtaacagccatatctttaaactgttctaggctttc |
10844364 |
T |
 |
| Q |
114 |
aagtgtttcaacaatcatcgccattcttggtctgtctttaggatgcagacttatacattgcaatgccaaatgtgcaatctcttttgcacctttgacagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10844365 |
aagtgtttcaacaatcatcgccattcttggtctgtctttaggatgcagacttatacattgcaatgccaaatgtgcaatctcttttgcacctttgacagaa |
10844464 |
T |
 |
| Q |
214 |
tattgtcccgcaagccttggatccataatgtacctcaatcttctactgctactcaagtaaggctttgtccaatccacgatgttttgttctgtctttggtc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10844465 |
tattgtcccgcaagccttggatccataatgtacctcaatcttctactgctactcaagtaaggctttgtccaatccacaatgttttgttctgtctttggtc |
10844564 |
T |
 |
| Q |
314 |
ttgttttgtctgttgctcttctt |
336 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10844565 |
ttgttttgtctgttgctcttctt |
10844587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University