View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_low_65 (Length: 215)
Name: NF9753_2D_low_65
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 34573128 - 34572936
Alignment:
| Q |
1 |
caacaaaatattcatctaaaatggatccatagccactagatttttatcatagtaccgttccgacatagcaaagttgttctccataagacttgtaaaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34573128 |
caacaaaatattcatctaaaatggatccatagccactagatttttatcatagtaccgttccgacatagcaaagttgttctccatcagacttgtaaaacat |
34573029 |
T |
|
| Q |
101 |
tgattgcactttatgaaattgaacttgatgtcatcttgattgaacctggctcttgataataggttttggcaatttaaacagaatactgaactcc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
34573028 |
tgattgcactttatgaaattgaacttgatgtcatcttgattgaacctggatcttgatactagg-tttggcaatttaaacagaatactgaactcc |
34572936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 155
Target Start/End: Complemental strand, 38474240 - 38474176
Alignment:
| Q |
91 |
tgtaaaacattgattgcactttatgaaattgaacttgatgtcatcttgattgaacctggctcttg |
155 |
Q |
| |
|
||||||| |||||||||||| ||||| ||||| || |||| ||||||||| ||||||||||||| |
|
|
| T |
38474240 |
tgtaaaatgttgattgcacttgatgaatttgaagttaatgttatcttgattcaacctggctcttg |
38474176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University