View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_low_66 (Length: 210)
Name: NF9753_2D_low_66
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 29 - 191
Target Start/End: Complemental strand, 23840349 - 23840189
Alignment:
| Q |
29 |
gatatgaaggtaagaatatatttaaaatttgcttattattcaaaaccatttcttggtttgtgaaaaacttagcttaaaaacatgtacataacattgggga |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
23840349 |
gataagaaggtaagaatatatttaaaattttcttattaatcaaaaccatttcttagtttgtgaaaa-cttagctttaaaacatgtatataacattgggga |
23840251 |
T |
 |
| Q |
129 |
gtaagtgtttgtattttgtgacggttatttaagttttctagcataagtactaatcaaatgttt |
191 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23840250 |
gtaagtgtttgtattttgtgatggttatttaag-tttctagcataagtactaatcaaatgttt |
23840189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University