View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_2D_low_72 (Length: 208)
Name: NF9753_2D_low_72
Description: NF9753_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_2D_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 35128288 - 35128111
Alignment:
| Q |
9 |
aaatttaggattaatatgtaacttgttgcataattaggattattctcactatttattatcgttgatatattttatatttttgacaaaaacaaatctttag |
108 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128288 |
aaatttaggattattatgtaacttgttacataattaggattattctcactatttattatcgtatatatattttatatttttgacaaaaacaaatctttat |
35128189 |
T |
|
| Q |
109 |
acatattgtatagcag-tattgtgtaatgggagttatttatccatcttgtccttcatctttttgtcttctcctcaaga |
185 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128188 |
acatattgtatagcagttattgtgtaatgggagttatttatccatcttgtccttcatctttttgtcttctcctcaaga |
35128111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University