View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_high_32 (Length: 256)
Name: NF9753_high_32
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 33242155 - 33242390
Alignment:
| Q |
1 |
acagaaaaggttctttacgtggacattcacgctctcaatctaagagtgaaggatgtcttcgtgaatggagcttggaattttaatcatcactacacaactc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33242155 |
acagaaaaggttctttatgtggacattcacgatctcaatctaagagtgaaggatgtcttcgtgaatggagcttggaattttaatcatatctacacaactc |
33242254 |
T |
|
| Q |
101 |
tccctacttctactacagatagcttgaaaatgccccccatttgcctgaattccccgcgtgactgatgggtatacatggaaaggtaatctccatggtattt |
200 |
Q |
| |
|
||||| | |||| |||||||||||||||||| | ||||||||||||||| | |||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33242255 |
tccctgcatctattacagatagcttgaaaattctccccatttgcctgaact-cccgcgtgactgatgggtatacttggaaaggtaatcttcatggtattt |
33242353 |
T |
|
| Q |
201 |
actcagcacgagatggatattattgggtgaacatgat |
237 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33242354 |
actcagcagaggatggatattattggttgaacatgat |
33242390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 33250076 - 33250311
Alignment:
| Q |
1 |
acagaaaaggttctttacgtggacattcacgctctcaatctaagagtgaaggatgtcttcgtgaatggagcttggaattttaatcatcactacacaactc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33250076 |
acagaaaaggttctttatgtggacattcacgatctcaatctaagagtgaaggatgtcttcgtgaatggagcttggaattttaatcatatctacacaactc |
33250175 |
T |
|
| Q |
101 |
tccctacttctactacagatagcttgaaaatgccccccatttgcctgaattccccgcgtgactgatgggtatacatggaaaggtaatctccatggtattt |
200 |
Q |
| |
|
||||| | |||| |||||||||||||||||| | ||||||||||||||| | |||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
33250176 |
tccctgcatctattacagatagcttgaaaattctccccatttgcctgaact-cccgcgtgactgatgggtatacttggaaaggtaatcttcatggtattt |
33250274 |
T |
|
| Q |
201 |
actcagcacgagatggatattattgggtgaacatgat |
237 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| |
|
|
| T |
33250275 |
actcagcagaggatggatattattggttgaacatgat |
33250311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University