View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_21 (Length: 370)
Name: NF9753_low_21
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 335
Target Start/End: Original strand, 38423459 - 38423773
Alignment:
| Q |
21 |
tcagtatctactcgtgtctggtaagtaagaccccttcgttctagttttctataaattcnnnnnnntgctaataagtgttgtgtattgatcaagatgcgta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||| || |
|
|
| T |
38423459 |
tcagtatctactcgtgtctggtaagtaagaccccttccttctagttttctataaattcaaaaaaatgctaataattgttgtgtattgatcaagatg--ta |
38423556 |
T |
 |
| Q |
121 |
cggttcacaaaagaagctagaattcatctttaaaaagatgaatttttaactaataggttatttgacaaaaagaaaa--cagnnnnnnncaatgtaaaact |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||| |||||||||||| |
|
|
| T |
38423557 |
tggttcacaaaagaagctagaattcatctttaaaaagatgaatttttaactaatagattatttgacaaaaaaaaaaaacagtttttttcaatgtaaaact |
38423656 |
T |
 |
| Q |
219 |
tcaacttttattttctttaactagtatatcgtatcaccagttaacctccctaagaactcaaaattaaaattaacattccnnnnnnnnnatgttaacattc |
318 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38423657 |
ttaacttttattttctttaactagtatatcgtatcaccagttaacctccctaagaactcaaaattaaaattaacattcctttttttttatgttaacattc |
38423756 |
T |
 |
| Q |
319 |
ttttctctaactgaacc |
335 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38423757 |
ttttctctaactgaacc |
38423773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University