View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_38 (Length: 257)
Name: NF9753_low_38
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 40729706 - 40729948
Alignment:
| Q |
1 |
attttaattcaagaatggagatcaaattttctcttttgcgtgtttaagctcggacaacttgtttaggaaaacctaaattcgattttgggtagaaataata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40729706 |
attttaattcaagaatggagatcaaattttctcttttgcgtgtttaagctcggacaatttgttttggaaaacctaaattcgattttgggtagaaataata |
40729805 |
T |
 |
| Q |
101 |
tttagccaaattttatttatttttcgatcgaactttgaatttttacaatcacattcattatctaagaaccggatgattagaacnnnnnnnnttgttcttt |
200 |
Q |
| |
|
|||| ||||||||||| || |||||||||||||| |||||||||||||||||||| || |||||| |||||||||||||| ||||||||| |
|
|
| T |
40729806 |
tttaaccaaattttatatacttttcgatcgaactctgaatttttacaatcacattgat----taagaatcggatgattagaacaaaaaaaattgttcttt |
40729901 |
T |
 |
| Q |
201 |
cacaattttagcacgaaccaaattatatcgagataaacttgtctctg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40729902 |
cacaattttagcacgaaccaaattatatcgagataaacttgtctctg |
40729948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University