View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_49 (Length: 241)
Name: NF9753_low_49
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 76 - 240
Target Start/End: Complemental strand, 10660496 - 10660332
Alignment:
| Q |
76 |
catttctctaaaataataaaatcaaataagtgagtggaagttcaacaattgtaatcatttttatgggaaatgatatcaacctgtcaacgtatattatttc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10660496 |
catttctctaaaataataaaatcaaataagagagtggaagttcaacaattgcaatcatttttatgggaaatgatatcaacctttcaacgtatattatttc |
10660397 |
T |
 |
| Q |
176 |
tattatctcaggcaaatgaacattccaactatttgactaagctatatttctagtagttctctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10660396 |
tattatctcaggcaaatgaacattccaactatttgactaagctatctttctagtagttctctctg |
10660332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 10660601 - 10660538
Alignment:
| Q |
1 |
cgttcaactacttgagaatttgtttcattgacttagcttgttgccacattttcaaatatattta |
64 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10660601 |
cgttcaactatttgagaatttgtttcattgacttagcttgttgccacattttcaaatatattta |
10660538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University