View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_50 (Length: 241)
Name: NF9753_low_50
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 10661012 - 10661235
Alignment:
| Q |
1 |
tcgaaagaaaaatcttttgaacttgaagttgtgccgatttcatgtctaacgctaaccggcaattcagttgtcgaaaatgactcgacaattggtatctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661012 |
tcgaaagaaaaatcttttgaacttgaagttgtgccgatttcatgtctaacgctaaccggcaattcagttgtcgaaaatgactcgacaattggtatctcaa |
10661111 |
T |
|
| Q |
101 |
tctcagatgctactgtttggttgtttcttggtgaagttgatcctcctccttcaacatcccattgctcattttcatagttagaagtccttggagaagtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661112 |
tctcagatgctactgtttggttgtttcttggtgaagttgatcctcctccttcaacatcccattgctcattttcatagttagaagtccttggagaagtttg |
10661211 |
T |
|
| Q |
201 |
taaactgtcactgttgccaaaagt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10661212 |
taaactgtcactgttgccaaaagt |
10661235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University