View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_52 (Length: 239)
Name: NF9753_low_52
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51114875 - 51115097
Alignment:
| Q |
1 |
attggtttttgaagctattgacaaactactcattcttttctgcattgattcgagtgtttaattagttttaatatggtcaataacaaggtataatcaaaat |
100 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114875 |
attggtttttgaaactattgactgactactcattcttttctgcattgattcgagtgtttaattagttttaatatggtcaataacaaggtataatcaaaat |
51114974 |
T |
 |
| Q |
101 |
ctagtagcaaccttagatagtgttgaatgcacgttagttatcaaaaaggaaatcctgagtttggaaattaggtggttgttctctgtatcaatatttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51114975 |
ctagtagcaaccttagatagtgttgaatgcacgttagttatcaaaaaggaaatcctgagtttggaaattaggtggttgttctctgtttcaatatttcaaa |
51115074 |
T |
 |
| Q |
201 |
tacaatggatggcttacaaaact |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51115075 |
tacaatggatggcttacaaaact |
51115097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University