View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_54 (Length: 238)
Name: NF9753_low_54
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 45392579 - 45392354
Alignment:
| Q |
1 |
gtatgatacatattgatcttagttgtctgtctgtcgcacattaattgttgatgtttttgtttcttgcacgaactgcattggcgatacttgagatgtaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45392579 |
gtatgatacatattgatcttagttgtctgtctgtcgcacattaattgttgatgtttttgtttcttgcacgaactgcattggcgatacttgagatgtaata |
45392480 |
T |
|
| Q |
101 |
atttcttttttgctgcttattcactaagaatttattcttgatttggcttattacttgattgaggctactgaatttaacatttgaaagttgtggtcctgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45392479 |
atttcttttttgctgcttattcactaagaatttattcttgatttggcttattgcttgattgaggctactgaatttaacatttgaaagttgtggtcctgat |
45392380 |
T |
|
| Q |
201 |
tacgtgaatgtgagatcctctaactg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45392379 |
tacgtgaatgtgagatcctctaactg |
45392354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 219
Target Start/End: Complemental strand, 52739307 - 52739234
Alignment:
| Q |
146 |
gcttattacttgattgaggctactgaatttaacatttgaaagttgtggtcctgattacgtgaatgtgagatcct |
219 |
Q |
| |
|
||||||| | ||||| ||||||||||||||| ||||||| |||||||||||| | | ||||||||||||||| |
|
|
| T |
52739307 |
gcttattgcatgattatggctactgaatttaatgtttgaaaattgtggtcctgactgcatgaatgtgagatcct |
52739234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University