View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_57 (Length: 227)
Name: NF9753_low_57
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_57 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 44136965 - 44136741
Alignment:
| Q |
1 |
gaacttgctattagtgtcgccgtctgctaaccaatagaccttagaacgttgacgccagtaagtttcctcttgtagaattagagaagcgagatttttctgc |
100 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44136965 |
gaacttgctattagtgtc--cgtctactaaccaatagaccttagaacgttgatgccagtaagtttcctcttgtagaattaaagaagcgagatttttctgc |
44136868 |
T |
|
| Q |
101 |
atactttccaattgcgggtcgttaccatcacacatagcattgcggaactcctctannnnnnncgcattgtttccggattagatgtctgtaatttggtgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44136867 |
atactttccaattgcgggtcgttaccatcacacatagcattgcggaactcttctatttttttcgcgttgtttccggattagatgtctgtaatttggtgca |
44136768 |
T |
|
| Q |
201 |
gcttctcggctccaagttgagatatct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44136767 |
gcttctcggctccaagttgagatatct |
44136741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University