View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9753_low_58 (Length: 223)
Name: NF9753_low_58
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9753_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 40 - 207
Target Start/End: Complemental strand, 48679233 - 48679067
Alignment:
| Q |
40 |
aatgataacgtatcaagttaattggttcagttttgtggattcttggggatgattctggttgttgcatgaaggtgttacacactcactagtaagaaagatt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48679233 |
aatgataacgtatcaagttaattggttcagttttgtggattcttggggatgattctggttgttgcatgaaggtgtcacacactcactagtaagaaagatt |
48679134 |
T |
|
| Q |
140 |
tgaaagattaattacaaggttgtgccaannnnnnnatttcaatatgattttgaatacttgtgttttct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
48679133 |
tgaaagattaattacaaggttgtgccaa-ttttttatttcaatctgattttgaatacttgtgttttct |
48679067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University