View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9753_low_63 (Length: 207)

Name: NF9753_low_63
Description: NF9753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9753_low_63
NF9753_low_63
[»] chr5 (2 HSPs)
chr5 (12-204)||(15616962-15617154)
chr5 (23-113)||(16042836-16042920)
[»] chr8 (1 HSPs)
chr8 (16-182)||(43219220-43219386)
[»] chr4 (1 HSPs)
chr4 (23-113)||(4608920-4609010)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 15616962 - 15617154
Alignment:
12 atcagtacggatcactctatatctatacttgatgaaccatggttagtgaatgaggatcacatagatggaaatattgtgggggtaaactttgtgagggatt 111  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
15616962 atcagtacgggtcactctatatctatacttgatgaaccatggttagtgaatgaggatgacatagatggaaatattgtgggggtaaactttgtgagggatt 15617061  T
112 ttcatatgaatagtttgatgaattcctcgtcgaatggctggaatgaggaagtgattcaacaagtgtttagtttcaatacagccgaatcttttc 204  Q
    |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |||||    
15617062 ttcatatgaatagtctgatgaattcctcgtcgaatggctagaatgaggaagtgattcaacaagtgtttagtttcaatacagctgaattttttc 15617154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 113
Target Start/End: Original strand, 16042836 - 16042920
Alignment:
23 tcactctatatctatacttgatgaaccatggttagtgaatgaggatcacatagatggaaatattgtgggggtaaactttgtgagggatttt 113  Q
    |||||||||||| |||||| |||||||||      | |||| ||||||||| |||||||||||| |||| | |||||||||||||||||||    
16042836 tcactctatatcaatactttatgaaccat------taaatggggatcacatggatggaaatattatgggtgaaaactttgtgagggatttt 16042920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 16 - 182
Target Start/End: Complemental strand, 43219386 - 43219220
Alignment:
16 gtacggatcactctatatctatacttgatgaaccatggttagtgaatgaggatcacatagatggaaatattgtgggggtaaactttgtgagggattttca 115  Q
    |||||| |||||||||||| |||||||||||||| |||||  |||||| ||| | ||| |||||||||||| |||| | ||||||||||||||||||| |    
43219386 gtacgggtcactctatatcaatacttgatgaaccttggttgttgaatggggaccgcattgatggaaatattatgggtgcaaactttgtgagggattttta 43219287  T
116 tatgaatagtttgatgaattcctcgtcgaatggctggaatgaggaagtgattcaacaagtgtttagt 182  Q
    |  || |||| ||||| ||  |||| |||| || |||||  ||||||| ||||||||||||||||||    
43219286 tgggagtagtctgatgcatgtctcgacgaagggttggaaccaggaagttattcaacaagtgtttagt 43219220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 23 - 113
Target Start/End: Original strand, 4608920 - 4609010
Alignment:
23 tcactctatatctatacttgatgaaccatggttagtgaatgaggatcacatagatggaaatattgtgggggtaaactttgtgagggatttt 113  Q
    ||||||||||||||||||| ||||  |||||||  |||||| ||| | |||||||||||||| |||||||  |||||||||||||||||||    
4608920 tcactctatatctatacttcatgagtcatggtttttgaatggggaccgcatagatggaaatagtgtggggaaaaactttgtgagggatttt 4609010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University