View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9754_high_6 (Length: 254)
Name: NF9754_high_6
Description: NF9754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9754_high_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 254
Target Start/End: Complemental strand, 12753461 - 12753233
Alignment:
| Q |
25 |
gacacagacacgatcacaccgctaataatttnnnnnnnntcacataatttagtataatcatatatacgtgtcgatgtcatgtcgatgttgaacattaacg |
124 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||||| |||||||||||||| |||||| |||||||||||||| ||||||||| | |
|
|
| T |
12753461 |
gacacatacacgatcacaccgctaataatttgagaaaaatcaca--atttaatataatcatatatatgtgtcggtgtcatgtcgatgtcgaacattaatg |
12753364 |
T |
|
| Q |
125 |
cgtgtccgacaccaaaacacgtttaatccaaggactatgtgcacttcatagatccaaagaaactaacataatcacat-gttactattattttcctataag |
223 |
Q |
| |
|
||||||||||||| |||||| |||||||| |||| ||| |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
12753363 |
cgtgtccgacaccgaaacacatttaatccgaggagtatatgcacttcatagatccaaagaaactaacataatcacgtctttactattattttcctataag |
12753264 |
T |
|
| Q |
224 |
agaaagtgatcgaacgggtaaccaacccacc |
254 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
12753263 |
agaaagtgatcgaaccggtaaccaacccacc |
12753233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University