View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9754_high_8 (Length: 238)
Name: NF9754_high_8
Description: NF9754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9754_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 25379986 - 25379766
Alignment:
| Q |
1 |
attctacctaactcaatcacatacaacgaatatacacatatatcttaacttcttaggctactaactattagctacactaaagatactccaatactgcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379986 |
attctacctaactcaatcacatacaacgaatatacacatatatcttaacttcttaggctactaactattagctacactaaagatactccaatactgcttt |
25379887 |
T |
|
| Q |
101 |
gataatacactgtcgagctgtgttgcttacctttgattggtggaagattttgcctcctttttctgtatagggaaacaaatggtacagttagtgaaattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25379886 |
gataatacactgtcgagctgtgttgcttacctttgattggtggaagattttgcctcctttttctgtatagggaaacaaatggtacagttagtgaaattta |
25379787 |
T |
|
| Q |
201 |
agccataagcctactaataac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25379786 |
agccataagcctactaataac |
25379766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 201
Target Start/End: Original strand, 38341114 - 38341165
Alignment:
| Q |
150 |
ttgcctcctttttctgtatagggaaacaaatggtacagttagtgaaatttaa |
201 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||| ||||||||||| |
|
|
| T |
38341114 |
ttgcctcctttttctacatagagaaacaaatggaacagttggtgaaatttaa |
38341165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University