View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9754_low_12 (Length: 233)
Name: NF9754_low_12
Description: NF9754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9754_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 45549447 - 45549649
Alignment:
| Q |
13 |
caaagggttatatattttagttcgtgaaagacatatcatgtaactgttagatttatattatgtaatttatgttcatatgacataaattggcggttttaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549447 |
caaagggttatatattttagttcgtgaaagacatatcatgtaactgttagatttatattatgtaatttatgttcatatgacataaattggcggttttaga |
45549546 |
T |
|
| Q |
113 |
tcctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagcattgtacaacgtagaagtaggaagcagttcatgttct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45549547 |
tcctactcagtcagtgcttaccaaatcattggccgattcttgtaaatcttcactcttgccagaattgtacaacgtagaagtaggaagcagttcatgttct |
45549646 |
T |
|
| Q |
213 |
gtg |
215 |
Q |
| |
|
||| |
|
|
| T |
45549647 |
gtg |
45549649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University