View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9754_low_8 (Length: 254)
Name: NF9754_low_8
Description: NF9754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9754_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 31737563 - 31737668
Alignment:
| Q |
1 |
ttctggactggtctagtattgattaacttatttttgtctgaggtaaaaaccatggactttggatccctttcaaatgatagactaccgcaatggtaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31737563 |
ttctggactggtctagtattgattcacttatttttgtctgaggtaaaaaccatggactttggatcactttcaaatgatagactaccgcaatggtaataaa |
31737662 |
T |
|
| Q |
101 |
aatctt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
31737663 |
aatctt |
31737668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 2 - 106
Target Start/End: Original strand, 31703182 - 31703285
Alignment:
| Q |
2 |
tctggactggtctagtattgattaacttatttttgtctgaggtaaaaaccatggactttggatccctttcaaatgatagactaccgcaatggtaataaaa |
101 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||| || | |||||||||| |
|
|
| T |
31703182 |
tctggactg-tctagtattgattaacttatttttgtccgaggtaaaaactatggactttggatcactttccaatgatagactatcgtgacggtaataaaa |
31703280 |
T |
|
| Q |
102 |
atctt |
106 |
Q |
| |
|
||||| |
|
|
| T |
31703281 |
atctt |
31703285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 104 - 196
Target Start/End: Original strand, 31737700 - 31737791
Alignment:
| Q |
104 |
cttaataaaattttgtattggtactataaactaatgtaatatcagggcaaaatcgatcannnnnnnngcttctaatgccctacttaggtgttc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31737700 |
cttaataaaattttgtattggtactataaactaatgtaatatcagggcaaaatcgatca-tttttttgcttctaatgccctacttaggtgttc |
31737791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University