View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9755_high_4 (Length: 246)

Name: NF9755_high_4
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9755_high_4
NF9755_high_4
[»] chr5 (1 HSPs)
chr5 (1-233)||(8411966-8412198)


Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 8411966 - 8412198
Alignment:
1 cttctgcaacttgtcaacctttcgtataatcaattctccggtgagattccggcgaggtttggtgagcttcagaaactgcaatatctatggcttgatcata 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
8411966 cttctgcaacttgtcaacctttcgtataatcaattctccggtgagattccggcgaggtttggtgagcttcagaaactgcaatttctatggcttgatcata 8412065  T
101 actttctcggaggaacactaccttctgcacttgcaaattgttcttcgctggtgcatttgagtgctgaaggaaattcactttccggcgtgattccgtcggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8412066 actttctcggaggaacactaccttctgcacttgcaaattgttcttcgctggtgcatttgagtgctgaaggaaattcactttccggcgtgattccgtcggc 8412165  T
201 gatttcggcgcttccgatgcttcaggtgatgtc 233  Q
    |||||||||||||||||||||||||||||||||    
8412166 gatttcggcgcttccgatgcttcaggtgatgtc 8412198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University