View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9755_high_5 (Length: 207)
Name: NF9755_high_5
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9755_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 53990238 - 53990064
Alignment:
| Q |
13 |
cataggctaaatagaatactaagtatatagtatgctgcaacagtttgacaaaattaattaattttgttttataagttacttataactgtgtatggacata |
112 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
53990238 |
cataagctaaatagaatacta----tatagtatgctgcaacagtttgacaaaattaattaattttgtttgataagttacttataactgtgtatggaaata |
53990143 |
T |
 |
| Q |
113 |
gttgcaatgattgaaacgtagtataaatatataatattaatgctaaatgatattctgtgtacaattttatactattttg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53990142 |
gttgcaatgattgaaacgtagtataaatatataatattaatgctaaatgatattctgtgtacaattttatactattttg |
53990064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University