View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9755_low_12 (Length: 243)
Name: NF9755_low_12
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9755_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 91 - 223
Target Start/End: Complemental strand, 13726690 - 13726558
Alignment:
| Q |
91 |
tgccacaccacattaggaaaaggtctaaatcctacatggaaaggtcacaatcaattgatgctttgcaatcttttttgttcaatggattcattgattagaa |
190 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
13726690 |
tgccacaccacattaggaaaaggtcaaaatcctacatggaaaggtcacaatcacttgatgctttgctatcttttttgttcaatgcattcattgattagaa |
13726591 |
T |
|
| Q |
191 |
tatcattatgtctattacttttacacccttctt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13726590 |
tatcattatgtctattacttttacacccttctt |
13726558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 13727030 - 13726980
Alignment:
| Q |
1 |
cccaagttggcattgttgttcttccttctattgaaatgctcgatgttggtg |
51 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13727030 |
cccaagttggcattgttgtccttccttctattgaaatgctcgatgttggtg |
13726980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University