View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9755_low_15 (Length: 205)
Name: NF9755_low_15
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9755_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 35 - 190
Target Start/End: Original strand, 1665432 - 1665587
Alignment:
| Q |
35 |
tttgtttttgcagttaagctcctcgattggggtgaagagggccatcggtcagacgccgaaatagcctcattgagagcggcttttacccaagaagttgccg |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1665432 |
tttgtttttgcagttaagctcctcgattggggtgaagagggccatcggtcagacgccgaaatagcctcattgagagcggcttttacccaagaagttgccg |
1665531 |
T |
 |
| Q |
135 |
tatggcacaagcttgaccatcctaacgtaaccagggtaatatttcgggttttttct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1665532 |
tatggcacaagcttgaccatcctaacgtaaccagggtaatatttcgggttttttct |
1665587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 1760066 - 1760100
Alignment:
| Q |
1 |
caaagagaaaaatttggattcaagatctttttcat |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
1760066 |
caaagagaaaaatttggattcaaggtctttttcat |
1760100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University