View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9755_low_5 (Length: 332)
Name: NF9755_low_5
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9755_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 14459906 - 14459836
Alignment:
| Q |
17 |
ttaagtcggttttaaaagtttgtttctaaattgaaatttaagtttgttttaagtctgaacttattgtagtg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14459906 |
ttaagtcggttttaaaagtttgtttctaaattgagatttaagtttgttttaagtctgaacttattgtagtg |
14459836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 101 - 131
Target Start/End: Complemental strand, 14459825 - 14459795
Alignment:
| Q |
101 |
accagagtgacgttttcaaacatcctcatca |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14459825 |
accagagtgacgttttcaaacatcctcatca |
14459795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University