View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9755_low_6 (Length: 331)
Name: NF9755_low_6
Description: NF9755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9755_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 321
Target Start/End: Original strand, 8411664 - 8411967
Alignment:
| Q |
18 |
aacatcttggcgaattacgcatgttgaggaagttaagcctccgttccaatttcttcaacggaaccattccgagaacgctttcgaaatgcaagcttttgag |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411664 |
aacatcttggcgagttacgcatgttgaggaagttaagcctccgttccaatttcttcaacggaaccattccgagaacgctttcgaaatgcaagcttttgag |
8411763 |
T |
 |
| Q |
118 |
gtttttgtttttgcaagataatcaattttctggtcatattccgccggagatcggaaacctcactggtctaatgattctaaatgttgctcaaaatcacctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411764 |
gtttttgtttttgcaagataatcaattttctggtgatattccgccggagatcggaaacctcactggtctaatgattctaaatgttgctcaaaatcacctc |
8411863 |
T |
 |
| Q |
218 |
accggaactgttccaagttcgcttccggttggtcttaagtatcttgacgtatcgtcgaatgcgttctccggtgagattccggtgaccgttggtaatttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411864 |
accggaactgttccaagttcgcttccggttggtcttaagtatcttgacgtatcgtcgaatgcgttctccggtgagattccggtgaccgttggtaatttat |
8411963 |
T |
 |
| Q |
318 |
ctct |
321 |
Q |
| |
|
|||| |
|
|
| T |
8411964 |
ctct |
8411967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University